Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11130B4
Clone ID IST11130B4
Vector VICTR76
Project tigm

Sequence tag IST11130B4BBF1
Sequence
GAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACACAAAACTAGCCAGTACACC
ATGTAATTGTTAACATCAGGTCCCCCCCACCCCCACATCANATTTACTAAACTGAGCAAGAAGAGTAAGGTAAGCAGCTA
GTATTTTATGGCCCCTGTGCTGTAAATGAATTCATCCCCAAGTTTATCCTCTTGTGCTATATAATACCTATNNGANACAA
TTTATTGGGGAAAATTAAATTTAAAGGCTGTGAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93514392..93514670 271
NO GENE  


Sequence tag IST11130B4HMF2
Sequence
GAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI5967 UNI35231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23175503..23175562 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24679877..24679936 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66509592..66509651 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11533438..11533497 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071669 (Snx29) NM_028964 sorting nexin 29 Gene [Source:MGI Symbol;Acc:MGI:1921728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 40975189..40975248 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 89436974..89437033 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034488 (Edil3) NM_010103 EGF-like repeats and discoidin I-like domains 3 Gene [Source:MGI (curated);Acc:Edil3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 13638195..13638254 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27761192..27761251 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108671915..108671974 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 111680080..111680139 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 13177962..13178021 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 49333870..49333929 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115772383..115772442 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39549591..39549650 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12885784..12885843 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 94115441..94115500 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 53485873..53485932 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14612860..14612919 60
NO GENE  

 
Come back to gene ENSMUSG00000034488


For any suggestions or comments, please send an email to unitrap@crg.es