Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12455E11
Clone ID IST12455E11
Vector VICTR76
Project tigm

Sequence tag IST12455E11HMF1
Sequence
AGAACAAGGCAGAAGGGTCCCATCTCAAACTGTACCGGAAACACCCAGATCTACCCTTCAGTCCCCCTTGCAAAAGTGTA
ATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97662141..97662222 82
NO GENE  


Sequence tag IST12455E11BBF1
Sequence
AGAACAAGGCAGAAGGGTCCCATCTCAAACTGTACCGGAAACNCCCNNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97662177..97662222 44
NO GENE  


Sequence tag IST12455E11HMR1
Sequence
TTCNGAACCCANTNNNNTNTNNNNNNNCNGTTTNTTCTCTTGTGACCCCCTCTGCAGGGAAGCCTTTTGGCTCCTCATAG
ATACGTTGTACCTGGCTCTCCAAGCTGGATCTCATTCTCCACGTTTATGGCTGAACTGGACAGAAGCAGGCGCCTCANTG
AGGCGATCTAGTTTTGTTGGAAAAGGATACTTTGTTTCTCCGGGCTAGGGTTAGTTCCTTCTTAGGAACCTTTGGACATC
CCCCGCACACCCTCCCGGTCCCGGTCAGGAGGTAGGGACTTGTAGTTTTGAAACATTTGAACTTTTTCTTGANGANNNAG
ATGTGGGGCTTGN
Sequence Type genomic DNA
Unitrap ID UNI29628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97662249..97662551 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es