Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7408-NR
Clone ID PST7408-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7408-NR
Sequence
GTTGTGAACCACTTGCTGTGCCTTCTTGGAACTTGAACTCTGGAATAACAGTACATACCCCTAACTGCTGAGAGAACCTC
TCTAGCCCCTCCTCACTCAGGCATTTGTATTTATGTGACGTTACCTTTTTTGTGGCCCAGCTAGCCACAGCCTCCTGTGC
TCATTGATAGGTGGTTCTGAACCCTTGGCCTTCACATAGGCTAGGCATG
Sequence Type genomic DNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46415521..46415728 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es