Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14313H10
Clone ID IST14313H10
Vector VICTR74
Project tigm

Sequence tag IST14313H10BBF1
Sequence
ATGTAAGCCAGGCAATCCTGGCACACTATAATCCCAGTACTGAGGAAAGCAGAGGTAGGAGACTGCCCACAAGCTCCAGG
CCAACCTGGCACAGAGTTATAACCCTGTCTTTAATAACAAAAAAACGGAGTGTAGTCACACACAAATCTTAGCAGAGGAA
AGGCTAGGACAGGAGGATCTGAAGTTCAAGGCTAACCTAGTCTTTGTAGTGAGACTGGATGCTAATCTGAGCTACATGAA
ACTCCACCTTTAAAAACAACAACAACAACAAAAAAAAAAANNGGNNNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72839981..72840260 280
 
EST/CDNA Est Name
  BE985840.1


Sequence tag IST14313H10HMR1
Sequence
ACATTATTTTTAGTGACAGTGTCTTCCTACCGCATTTCAACCAGGAAAACCTGCTTTTTACGGAGATGAGTCTTTGCACT
CACTGATAGGATTACTATGACCAGAGAAAAAGAGCCTTATATCCTGTACTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72840257..72840391 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]


Sequence tag IST14313H10HMF1
Sequence
ATGTAAGCNNGGCAATCCTGGCACACTATAATCCCAGTACTGAGGAAAGCANAGGTAGGANACTGCCCACAAGCTCCAGG
CCAACCTGGCACAGAGTTATAACCCTGTCTTTAATAACAAAAAAACGGAGTGTANTCACACACAAATCTTAGCAGAGGAA
AGGCTAGGACAGGAGGATCTGAAGTTCAAGGCTAACCTAGTCTTTGTAGTGAGACTGGATGCTAATCTGAGCTACATGAA
ACTCCACCTTTAAAAACAACAACAACAACAAAAAAAAAAACGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72839976..72840260 271
 
EST/CDNA Est Name
  BE985840.1

 
Come back to gene BE985840.1


For any suggestions or comments, please send an email to unitrap@crg.es