Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10406F7
Clone ID IST10406F7
Vector VICTR76
Project tigm

Sequence tag IST10406F7HMF1
Sequence
AGGGAAACAACCCCTTCTTTCCTTCCTTCCTCCCTCCCTTCCTTCCCCAACTCATGCCTCCCTCATCCCTCCCCTCAGCC
CGAGTTCGTCAACGC

Sequence Type genomic DNA
Unitrap ID UNI34167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102009032..102009125 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023044 (Csad) NM_144942 cysteine sulfinic acid decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2180098]

 
Come back to gene ENSMUSG00000023044


For any suggestions or comments, please send an email to unitrap@crg.es