Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7247-NR
Clone ID PST7247-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7247-NR
Sequence
GTAGAAAGTATAGAGTTGGTCTTCTCTAACTACTAGTTCTGCATCTGGGCTTTCAACCAGCCAGTGCTCATGCTATGTGG
TTAGGTCTGTAGTAGTGACATG
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49778415..49778516 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es