Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7073-NR
Clone ID PST7073-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7073-NR
Sequence
CCTGCTCCTTCCCACAGCTGGCTTCGGAGGCATCCTGGGACTGGGCAGCCTGGGCCTGGGCTCCGCCAACTTTATGGAGC
TGCAGCAACAGATGCAGAGACAGCTCATGTCCAATCCTGAGATGCTGTCGCAGATCATGGAGAACCCCTTGGTCCAGGAT
ATGATGTCAAACCCTGATCTGATGCGCCACATGATCATGGCTAATCCCCACGATGCAGCAGCTGATGGAGAGGAACCCCG
AGATCAGCCACATG
Sequence Type genomic DNA
Unitrap ID UNI6027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88360562..88360814 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es