Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7037-NR
Clone ID PST7037-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7037-NR
Sequence
GTCACCACAGGCAGGATAGGTCTTCCCTCTTCGTGACCCTGATCTAGAAGCCCCTCACAGACAGGCCCAGAGGTTTGTTT
CCATTGCAATTTTAAATCCCACTAAGGTGATGTAAAGATTCATCATCACAGAGGCAAAGAGGGGAGGGAGGGGCATCCTC
AGGGTGACAGAGGCAGCAAAGAAAAGGGCCCTGAGTGGAGTCGGGTGTTGGGTGTCTGACTCAAACTTGCTGTCGGCGGG
GAGAAGGAGTCTGTGTGAGGAACGGGCAGAGAAAGA
Sequence Type genomic DNA
Unitrap ID UNI5398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142932071..142932346 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es