Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11129G11
Clone ID IST11129G11
Vector VICTR76
Project tigm

Sequence tag IST11129G11BBF1
Sequence
TTTCTCTTAAATCTCACACCTCTGAGGGTTTCANCCGGCCATTATGTGCTGAGTGTATTTTATATTCCTTAAAATCCCAG
TCAAAGGTGTCTACTCTCTAGCCATCATCTCCCTTGGCACTCCCACCTGCTGTCACCACGGGCCTTCTGCGGGCGGAATC
CCAAGTGGACCCTGCTTCTACTCAAGACCTGCCCGTCCCTCCCTTTACAGCTCCTTCTCTGCTTATGACCTTANCCTCAN
TCCCANCTATCCTAANCTGTCTGTGTGGGTGGNGGACACCCAACCTGTGAAAGGCANTGATTCCGTGGGACCCCAGTGTC
NNGANCATGCCTGCTGTCGCCTACANAGCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI35236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150920913..150921233 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037606 (Osbpl5) NM_024289 oxysterol binding protein-like 5 Gene [Source:MGI (curated);Acc:Osbpl5-002]

 
Come back to gene ENSMUSG00000037606


For any suggestions or comments, please send an email to unitrap@crg.es