Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14204A4
Clone ID IST14204A4
Vector VICTR74
Project tigm

Sequence tag IST14204A4HMF1
Sequence
GGGAGAAACTGAGCCCTCTGACCAAGGGGAGGANNGGGAAGGTAAGGATGAGGGTGATCACAGGTGGCGGTCCTCCCCAC
CTATGCATTGGTCAGATTAGGGTCANATTAGGGTCTCANCTCTACCATATATGCTGGGAATCTCTGGGTGTTTTTGCTTT
GTTTTGAAGGATTTGTTTATTTTTAATGCNCATTGGTGTTTTGCCTGCATGCNTGTCTGTGTGAGGGTGTCANATCCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250327..100250563 223
 
EST/CDNA Est Name
  CN696758.1 - CD554879.1 - BY082568.1 - BI557474.1


Sequence tag IST14204A4HMR1
Sequence
CTCCCAGACTCTCAGAAGTGAACTAAACCCCAGTCTGCAAGTAAGACAGACTCAGCACTGAGCATGGTGCCACCGTTCCT
GGAACTTGGAGCCTCTGTTTCCCCATCTATAAATTGGGAATCAGCAAAGGCCTACCGGCAGGGTTGGAAGTCACTGGCTA
TTAGAGAACAGGATGCTTGCCCTCTGATATCCTTTGACCTCTGCCTGGCCCTGGGCAACTTTCCAGCCTTTGCTTCCCTT
GGCTCCAGGCCTGGN
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250078..100250331 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es