Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14797A6
Clone ID IST14797A6
Vector VICTR76
Project tigm

Sequence tag IST14797A6HMR1
Sequence
NCCTAAACGGAGGACAAACTTCTTCAATGACAAAACTTTGATGTAGAGATATGGCTTAGTGGCTAANAGCACAGACTGCT
CATGCAGAGGTCCTGANTTCAATTCCCAGCCCCCACATGGTGGCTCATGACCATCTGTAATGGGATCTGATTCTCTTTTC
TGGTGTGTCTGAAGTCGGTGACAGTGTACTCACATACATAAAATAAATGAATCTAAAAAAAAAAACNAAAACAAAAAACC
TTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104152625..104152866 236
NO GENE  


Sequence tag IST14797A6HMF1
Sequence
GGATGAAAGCTGTAGACTTTCCCACCACTCCTGGGTAATCAGAAATGCTTTATAGTCTTTCTGGTCTCAAAACAGGCCAC
AAAGGCCAGGACACAGCTCACTTAGTTGGTGGACTGCCTGGTTTAGCATACGTGATTCCCAGGGCATCCCCCACCATGCT
ATAGATTGAGTGTGATGATGGAGAAGGAAGCCTCACAGCTTATAAACACTCATCTGAATGGA
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104152865..104153085 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14797A6BBF1
Sequence
GGATGAAAGCTGTAGACTTTCCCACCACTCCTGGGTAATCAGAAATGCTTTATAGTCTTTCTGGTCTCAAAACAGGCCAC
AAAGGCCAGGACACAGCTCACTTAGTTGGTGGACTGCCTGGTTTAGCATACGTGATTCCCAGGGCATCCCCCACCATGCT
ATAGATTGAGTGTGATGATGGAGAAGGAAGCCTCACAGCTTATAAACACTCATCTGAATGGCCAGTCAGATGTGACAGTC
AGGCCCACAGCCTTGTTCTAAACCAGCCGCTGCTCTGANCTAGTGCGGGGCAGGTGGGTAGGAGGGGACAGTGGCATCTC
NGCNNGAGCTTAGANGCN
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104152865..104153201 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es