Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14221H8
Clone ID IST14221H8
Vector VICTR74
Project tigm

Sequence tag IST14221H8HMF1
Sequence
ATTTAAATAATGAAAGGTAAAATAAAATTTTGACACCTTTTANAAGCACCATGCATTCATCACTACTCGTGAAAAGCAGC
CCTCAGCAAAGGATAACACGTGTCTACAAGACACACAACATGCTCCTGGGTTATGTACTACCTAACCATCACACACTGAG
GTTAGCAGCACAGTTAGCACTAGAAATCTAGACCCTGTGTTACTTTAAACAAACTGTCTAATAACCCCTCCCAACGGCGT
CAGTAGAGTTCACTAAAAAAGGAAAAGTTGGGCTGGAGATGGCTCAGCTGGTTAAGANCACTCACTCAGTGCTCTTCCNG
ANGTCCTGAGTTCAATTCCCANCAACCNCAAAGTGGCTCACAACCATCTGTAATGGGATCGATGCCCTCTTCTGGTGTGG
CTGATGACAGCTNTAATGTACTCACATNCNNAAAATANANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94830016..94830452 417
NO GENE  


Sequence tag IST14221H8HMR1
Sequence
ANNNNNACTGAGTATTTTAATAAAAAGAATACTGGAGGCTC
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94830457..94830490 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es