Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729D9
Clone ID IST14729D9
Vector VICTR76
Project tigm

Sequence tag IST14729D9BBF1
Sequence
TGGGCATCTAGCTACACTGTAGCTTATCTCTTGACTTCTTAGAGAGCTGATGTCACTTTGAGCCCATCAAAAAAGTTCCC
AAAGCCATAATATACTTAGGCCTCTTTTCTTCCTTAAGCGGTCATTAGGCCAGCGTATAAAAAGTCATAAAATGGATTAT
ATCCTTTGTGTGAATAACTTACTTCCTAGAATTTAGATTAAGGAAATAATTAAAAAGAAAGGGCCTCCAGGTACAAAAGC
AGTCTTGGCAGCACCATTCCTAACATGGGAAGGCAGGAAGTGTGTGGCAGGCAAGGAGCTGGTGCATCACGGGCACCTCG
GGACTTCACTGAAAGGACGGCACACCGGGCATATAAACACTGTGGTCANGCCAGGGAGANGTCTGGCAATGTGATCCTGA
NAAAAAGAAACAACTGTATCACCAGCGTGACTACTGCCCCGTCTANANCAATGTCACCGGCTAAAGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157198772..157199239 458
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14729D9HMF1
Sequence
TGGGCATCTAGCTACACTGTAGCTTATCTCTTGACTTCTTAGANAGCTGATGTCACTTTGAGCCCATCAAAAAAGTTCCC
AAAGCCATAATATACTTAGGCCTCTTTTCTTCCTTAAGCGGTCATTAGGCCAGCGTATAAAAAGTCATAAAATGGATNAT
ATCCTTTGTGTGAATAACTTACTTCCTAGAATTTAGATTAAGGAAATAATTAAAAAGANAGGGCCTCCAGGTACAAAAGC
AGTCTTGGCAGCACCATTCCTAACATGGGAAGGCANNAAGTGTGTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157198952..157199239 278
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14729D9HMR1
Sequence
TCCCCCAGAGTCCTGACTCCTGAAGTTTCTGTCACAGTATCCAGTCTTCATAATAACTTCGTTAGACTGAGTATCGATGC
CCTCAGTAGACTTCACAGATTTGAGCATGAAGCCTGGTCAGGGGCAGTAAGTTATGAGGTGCCACTGGAGGAGTGACGCT
TTCTTCAGCCTTAGCACAGGGCTGCTGCCCTGGAGAGCCTTGTCANCTCCCCTCACCCTGGAGCTGGGCTGGGCTGCCTT
GGAATTCACTTCAGAGCCAGCTAAGGAGCTGCTCCAAGCANTCTGCCTGCCTCCAAGCCTCGCACCTTGTGCATGACCNA
AGATGGAATCCTTGANCCCCATGCCCCACCTGACTCACTGTATTGGAACCNGCCACACTGGGCTCTCTCCANAANCNNNC
TCCTTCTCCGGANGAGGAAGTTCTGCCNGCTCTGANGATGGGGGGCGNNACAGTGAGTGAGGAGTGGCTCCTGCTTTGAA
AGGCTTCTANNNTCAGCTGANCTGATGTGAGACCTGN
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157199247..157199762 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es