Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12650C12
Clone ID IST12650C12
Vector VICTR76
Project tigm

Sequence tag IST12650C12BBF1
Sequence
CTCGGGACTTTTGATAGTATGAAATTATAGATTCCTCATGAGAAAAGATACTCAAAGTCATGGAGCAAGTCTTGCTCCAG
TTGTCTGCATTTTGCCTCTTANTAGTTTAGCCCACTTACTATTCTCATGATTGCTGTGGGTTAGGAATTTAAACAGGGCA
CATAAAAAGTGACTTTCCCCTGCCTTAAGATGTCTAGTACCTTAACTGGGAACACTCAGCATTTAAGGGTGATTTGACAG
GTAGTGGCCNNAACACATGGGGTGTCATCCTCCATGTGTGGTAGTGATGCTGGATATAGGTTGGCGGCTTANCATGGTGC
ATGACATGAATCTACNTCTGCATCTGCATGTGTTTATGCANTATTCAGCATGGCAGTTGAATTTCNCNNNNGGTGANGTA
ANANGTGTGAGTGTGGANNNAANCNNNNTCATGGTTCTAANCTAACCTTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12650C12HMF1
Sequence
CTCGGGACTTTTGATAGTATGAAATTATAGATTCCTCATGAGAAAAGATACTCAAAGTCATGGAGCAAGTCTTGCTCCAG
TTGTCTGCATTTTGCCTCTTAGTAGTTTAGCCCACTTACTATTCTCATGATTGCTGTGGGTTAGGAATTTAAACAGGGCA
CATAAAAAGTGACTTTCCCCTGCCTTAAGATGTCTAGTACCTTAACTGGGAACACTCNNCATTTAAGGGTGATTTGACNG
GTANTGGA
Sequence Type genomic DNA
Unitrap ID UNI7034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45551346..45551592 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es