Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6734-NR
Clone ID PST6734-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6734-NR
Sequence
AGTGTTGGTGGTTTTTAGTTTATAAAAAAGATGAGTAGTTGTCATGCCTTGTTTTAGATAGGCTTTTACAGGACTTGGAG
TGGCATGAAGACTGTGGCCGTGGGTAGATACCTTTCAAATACTTGATCATTCATGGCGCGCATAGAGGTTTCAAGTGTTT
TCTGTTAAGGTGCAAGATAAGCTGGTACGGTAGCTCACATCTTTAATCTCAGCATTCTGGAAGCTGAGGCTGCAGGATTG
TCATAGGGTCCAGCCCAGATCACACTACAGATGG
Sequence Type genomic DNA
Unitrap ID UNI15502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89221374..89221646 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028044 (Cks1b) NM_016904 CDC28 protein kinase 1b Gene [Source:MGI (curated);Acc:Cks1b-001]

 
Come back to gene ENSMUSG00000028044


For any suggestions or comments, please send an email to unitrap@crg.es