Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6724-NR
Clone ID PST6724-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6724-NR
Sequence
TATCCACTTTATATTTGCCATTCTAAGTAATGTCTCTTTGAAAAAGGAGTTAAGCTGGTGTGGTGATGTACACCTGCCAG
TGAGGCAGGATGCCTTAAACTCTTGGACTGCGTAGGCTGTTTAGATAGACATGACACTCAAAAAAAATTGTCAGGGGGAA
CTAATAGCACATCTAACATATTTGCTTGGAAATATAAAACAAGGGTGCTAGTTTATGGACTTATTTTTCTCTTTATTTAG
GAAACTGGGAAGAAATTGGTGAAGTATTTGCAG
Sequence Type genomic DNA
Unitrap ID UNI15503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86519601..86519871 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es