Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10526C4
Clone ID IST10526C4
Vector VICTR76
Project tigm

Sequence tag IST10526C4BBF1
Sequence
CTGCCTCCCTCCCACACACGCACTAAGTAACCCAGACTGACTTCATACTTGAGGTCTCCCTGCTTGAGCCTCTGGAGCAC
CTTCTGGGCCTGAGCTACCACCCTGCTCAGTAGCTGTGTGTCTTGCAATAGTGTTCTCCCAGCCGGGCGTGGTGGCGAAT
GCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCTGCCTGGTCTACAAAGTGAGTTCC
AGGACAGCCAGGGCTACACANANAAACCCTGTCTCTCTCAAAAAATAACAACAACAACAACAAAAGTGTTCTCCCTTGGA
TTTNTAAAAATCAACCATTTTAAAAAATAGAGAAANNNTCTTAACTTGTGGATGAAATANGCAAGAANCTAGATTTGGTC
CNNACTGGATATGTTGCCNATGTCTACCTCCNNACAGATTCANGCCTAAGAGANCN
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77701885..77702337 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]


Sequence tag IST10526C4HMF1
Sequence
CTGCCTCCCTCCCACACACGCACTAAGTAACCCAGACTGACTTCATACTTGAGGTCTCCCTGCTTGAGCCTCTGGAGCAC
CTTCTGGGCCTGAGCTACCACCCTGCTCAGTAGCTGTGTGTCTTGCANTAGTGTTCTCCCAGCCGGGCGTGGTGGCGAAT
GCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCTGCCTGGTCTACAAAGTGAGTTCN
AGGACAGCCAGGGCTACACANANAAACCCTGTCTCTCTCAAAAAATAACAACAACNACAACAAANGTGTTCTCCCTTGGA
TTTNTAAAAATCAACCATTTTAAAAAATAGAGAAACNNTCTTAACTTGTGGATGAAATAGGCAAGAAGCTAGATTTGGTC
CAAACTGGATATGTTGCNNATGTCTACCTCNNAACAGATTNANNCCTAAGAGAGCCCAGGTCTGAAAAGTGTTCCCGTGC
CTTACNCTGCAGCCCTGCATGANAAGCGTGCTCANATGTNNNANAGCTNNAATTAAGAAAGANGAAGANNAATGTGAATG
NNNCGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es