Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14985B9
Clone ID IST14985B9
Vector VICTR76
Project tigm

Sequence tag IST14985B9BBF1
Sequence
TCTTGAGAATGCTCAAGCTTTTTTGACAAGAAATGCTGAACTTGCTGGGCAGTGGTGGTGCACGCCTTTAATCCCAGCAC
TTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAC
ACAGAGAAACCCTTACTCGAAAAAAGACCAAAAGGAAAAAAGAAAAGAAAACAAGAAATAAATGCTGTCCCTGCCTGATC
CACTATCTCTTTATCTTGTTTTTANATGCCGGTGCAGCTGACTACAGCCCTGCGTGTGGTGGGCACCAGTCTGTTTGCCC
TGGTAGTGCTGGNANGCATCCTGGCNGCCTATGTGACAGGCNANNANTTTATCCNCNCNNANNAGCACTACCTGTCNNTT
GGCCTNTACNGTGCNNNNNNGNNTCTACATCTGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14985B9HMF1
Sequence
TCTTGAGAATGCTCAAGCTTTTTTGACAAGAAATGCTGAACTTGCTGGGCAGTGGTGGTGCACGCCTTTAATCCCAGCAC
TTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAC
ACAGAGAAACCCTTACTCGAAAAAAGACCAAAAGGAAAAAAGAAAAGAAAACAAGAAATAAATGCTGTCCCTGCCTGATC
CACTATCTCTTTATCTTGTTTTTANATGCCGGTGCAGCTGACTACAGCCCTGCGTGTGGTGGGCACCAGTCTGTTTGCCC
TGGTANTGCTGGGANGCANCNNGNCNNCCTNTGTGACAA
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109397543..109397900 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]


Sequence tag IST14985B9HMR1
Sequence
TAGTGTTTTNANTTTAAATTTGGGCCCTCANCAGTCATTTATCCTCAGCCACTTGAACAAAGATAAGTCTCTGGATTACA
ATACCATTTGTTGCAAAGAGAAACATTTTGTCTATGGGCATAAGCACAGATATTTCAAAGGCGTGTCAATTTAGTTAAAC
AACAGCAATAAGGTATCATTTTGAGTCATATTCCCAAACATAGGTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15050962..15051170 201
NO GENE  

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es