Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14151D3
Clone ID IST14151D3
Vector VICTR74
Project tigm

Sequence tag IST14151D3BBF1
Sequence
CCCCTTGGCTTGCTGAGTCNGTCCGCACTGACCTTCAAAATGATTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80813976..80814031 54
NO GENE  


Sequence tag IST14151D3HMR1
Sequence
NNNCNTATACTTTCTTTGCTTGAAACCCTTCAGTGGCTTTCTCATTGCCAAGGTGCTCATTACTTTAAAATAAAATGTAA
AATAATGTTCTGGGGATACAGTTCAGTTGCTGGATGCTTCCCTAGCATGCATGAATCCCTAGGGATTTTTTTCTTTGTTT
ATTTTTTTATTTATTTATTTTTTTTTTNNNAA
Sequence Type genomic DNA
Unitrap ID UNI19789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74550360..74550541 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es