Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15097G1
Clone ID IST15097G1
Vector VICTR80
Project tigm

Sequence tag IST15097G1HMR1
Sequence
CTANTCTTTANTCNANTGGTTGATTACCTCTGAAATAATGAAGTTGGCATTTCAAGAGAAGCATCATATTTGGAGATAAC
AACTTANAAATAANTAANTTGAAAAGGTGAGGGCAAAGGAGGAACGCTAGCAATTTANAAAATTTANTTGANATTGTAAA
TCTGGAAAGGCAGCAAGATAATGTTAGCATTAAAGCAGATGAGGAAATTTACTGCTGTTTATTTTCATCATTTCAAGCAA
GTTTTCTGCAAATCCTCCAACTGTGAAAGAGGATGGTAAATTCAAAATAGGTGGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82323344..82323641 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


Sequence tag IST15097G1BBF1
Sequence
AGCTAAGGTCCTGCGGATAGCAAACCAGCTTGCACAGAGTGAAACGCCCAATGCAGTCACGGAGGGTCCTACAACAGGGT
CAGTCAGCGAGGTGGGAGGGTGGAGGTAGCTGGGAAGACAGAGGAAAGGACTGAGTTGCAGGAGGCAGGGCCCAAGGAAA
GGGATTCTGCCCTANANCCTTCAGGGCTCACACACGCATGCATGCATGCATGCACGCACGCACGCACACACAGCAGCCCT
GCTGGCANCCTGGCTTTANGCCTGGGAGANACANCTCANGCACACAGAAGCNNANGANATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32033313..32033613 279
 
EST/CDNA Est Name
  AI503150.1 - R74718.1 - BF457060.1

 
Come back to gene AI503150.1 - R74718.1 - BF457060.1


For any suggestions or comments, please send an email to unitrap@crg.es