Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10537B2
Clone ID IST10537B2
Vector VICTR76
Project tigm

Sequence tag IST10537B2HMF2
Sequence
AAGTAAGGATGGATCTAAAACATGAATTTAATTTAGTTTTTTAGTCAATTTAATCAGGACATGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI15587 UNI30811 UNI32041 UNI32321 UNI32725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32509680..32509749 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38833425..38833494 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55706323..55706392 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8763259..8763328 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79509427..79509496 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047454 (Gphn) NM_172952 gephyrin Gene [Source:MGI Symbol;Acc:MGI:109602]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9872940..9873009 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7497630..7497699 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23578774..23578843 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 131623652..131623721 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056018 (1700008F21Rik) NP_083568 RIKEN cDNA 1700008F21 gene Gene [Source:MGI Symbol;Acc:MGI:1922703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520076..88520145 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 143433761..143433830 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88593657..88593726 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35315800..35315869 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140584..27140653 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11611605..11611674 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]


Sequence tag IST10537B2BBF1
Sequence
AAGTAAGGATGGATCTAAAACATGAATTTAATTTAGTTTTTTAGTCAATTTAATCNGGACATGAGTCAACTTACCTACCA
GCTCATCACACGAATTAATATGTTTCTGAAGCGTTCTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCTGTT
TTAGGATCAATCTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCCTTTATTAAACTCTTTGACATTAAAATA
TTANATTTTGAANATNANNGTAAGACTTANATAGTGTGAATGGGAATGCACTAAATAGTATGCACGGGGATACAATTTCT
CTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAANTTTACAATACCTAAACTTTTGAATNAATAACTAGTTGACNAAA
CATNNNANATACTTGGCTGTAAAGGGGCAGTGACNNATTGCACTTTTAATNNATTTTCTTAANGAGCAGTTGTAACTAGN
NGGCTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es