Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0307
Clone ID AH0307
Vector pGT0lxr
Project sanger

Sequence tag AH0307
Sequence
CCATCCTCTCGGCTGCTGTTTTTCTATCTCTCGATACTTGTTATTCATCTATCCCTTCTTAGTCCGGCTATCCTGCTGGA
AGGGGAGCTGGCCGGTGGGCCATGGCCGGCTGCAGGCTCTGGGTTTCGCTGCTGCTGGCGGCGGCGTTGGCTTGCTTGGC
CACGGCACTGTGGCCGTGGCCCCAGTACATCCAAACCTACCACCGGCGCTACACCCTGTACCCCAACAACTTCCAGTTCC
GGTACCATGTCAGTTCGGCCGCGCAGGCGGGCTGCGTCGTCCTCGACGAGGCCTTTCGACGCTACCGTAACCTGCTCTTC
GGTTCCGGCTCTTGGCCCCGACCCAGCTTCTCAA
Sequence Type mRNA
Unitrap ID UNI2797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59387494..59387783 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025232 (Hexa) NM_010421 hexosaminidase A Gene [Source:MGI Symbol;Acc:MGI:96073]

 
Come back to gene ENSMUSG00000025232


For any suggestions or comments, please send an email to unitrap@crg.es