Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15037G10
Clone ID IST15037G10
Vector VICTR78
Project tigm

Sequence tag IST15037G10BBF1
Sequence
AGAGCACCCCTCCATTCCATTTTGCCTGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGC
CAGATGCCCCCCTCCCCACACCTTCTTGGTTTTGATCTTTCCTGTTGTCCCTCTTCAAACCCCCCTTGCCTCCCTCCACC
GTCCACTTTCTCACCTCCTTTTTTTGGGTCCTGATCTCACAGCCTGTCCCTTAGCTGCGGCTGTCCCAGTTGTCAGGGAC
NNCANGTGGCTGTCCTTGNGCTCTTTGNGCN
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286899..148287168 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST15037G10HMF1
Sequence
AGAGCACCCCTCCATTCCATTTTGCCTGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGC
CAGC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286899..148286981 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST15037G10HMR1
Sequence
CTCTGTGGGACACTGGATGTGATGGGGGTGGTGAAGAGGGAGAGAAGAGGAGGACTGGANAAGAGGGAACGAGGTCTATT
AAAATCCTCTCANTGCATAACACAAAATGTCAGGGTTTATAGCTTCATTCTTGGCTTTGCTGGGACTGANAACCCTGAAC
AGAAATGTCACCGCTTGTCATGTTTAATCNCCTGCTGTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286700..148286902 195
NO GENE  

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es