Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13899C6
Clone ID IST13899C6
Vector VICTR74
Project tigm

Sequence tag IST13899C6HMF2
Sequence
CCAACTCTTCCAGGACCAGGTGTGCAAGAGCGGAGTGTGTGTGAACACGGCCCCAGGCTACTCTTGCTATTGCAGCAACG
GGTTCTACTATCACGCACACAGGCTGGAGTGCGTTGGTATGAGCCCCACCTTCCCCACCCCCAATTCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI10748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28094267..28094420 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST13899C6BBF1
Sequence
AACTGCTGAGTCNTCTCTCCAGATCCTTCATTGTCTCCNATGAAGAAGAAAGAAACAAAAGAAAGAAGGAAGAAGGAGAA
AGAAGAGAAAATGAAAAAGAAAAAGCCTGGAATTGTGTGCTCTATGCCTTTGATCCCAGCACTCTGGAGGCAGAGGTCAN
TGGGTTCAAGGTCAGCCTGGTGTACAGAAAACAGGAAATATATATGTGTGNGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52652178..52652390 205
NO GENE  

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es