Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14774H6
Clone ID IST14774H6
Vector VICTR76
Project tigm

Sequence tag IST14774H6HMF1
Sequence
GTTTCTTAGCAATTAGCAGCAGTACCCAAAAGACTGCTGTGTATCTGTGTATATTCTTTGCTTACCTCAACTCTCTGAAC
TATGGGGAGGAGTCCTATGGAGTGCTCACAAAAAGGGACCTAGCATAACTGCACTCTGACCCAGCAAGCACCTGAATGAG
TCAGATGCAGATATTTGCACCCAACCCATGGACAGAAACAGCTGACCTCTGTTGTTGAATTAGGGAAGGCTGAAAGAAAC
TGAGGACTCTGTAGGAGGACCAGCAGTCTCAGTTAGTCTGGATCCCTGANATCTATCCAACACAGAACCACCAAACAGAC
AGTATACACCAGCTGATATGAGGCTCTTAACACACATACAGTAGAGGACTGCCAGGTCTGTGTTCATTCATGATGTACCT
AACCCTCTANANACTGGANNCCCNNNAGTTTANAGGTCN
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16086676..16087115 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]


Sequence tag IST14774H6BBF1
Sequence
TTCTTAGCAATTAGCAGCAGTACCCAAAAGACTGCTGTGTATCTGTGTATATTCTTTGCTTACCTCAACTCTCTGAACTA
TGGGGAGGAGTCCTATGGAGTGCTCACAAAAAGGGACCTAGCATAACTGCACTCTGACCCAGCAAGCACCTGAATGAGTC
AGATGCAGATATTTGCACCCAACCCATGGACAGAAACAGCTGACCTCTGTTGTTGAATTAGGGAAGGCTGAAAGAAACTG
AGGACTCTGTAGGAGGACCAGCAGTCTCAGTTAGTCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16086832..16087113 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es