Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14799G1
Clone ID IST14799G1
Vector VICTR76
Project tigm

Sequence tag IST14799G1HMF1
Sequence
CATATACNTAAACATACACATATACATGAAATGTTNNTTGATCAAAGTTGCCTCATCCTCTCTTATCCCTCCCCCCCCCC
CN
Sequence Type genomic DNA
Unitrap ID UNI14516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84970413..84970493 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020042 (Btbd11) NM_001017525 BTB (POZ) domain containing 11 Gene [Source:MGI (curated);Acc:Btbd11-001]


Sequence tag IST14799G1BBF1
Sequence
GTACCAAGCCCAGCACTGATCCATAAAAGTCTTGATTTCCTGCTCAGCACAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126804923..126804979 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es