Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12405H7
Clone ID IST12405H7
Vector VICTR76
Project tigm

Sequence tag IST12405H7HMF1
Sequence
TGATGACCAGGTCGTGTTGTAAAATGGGGCTTGATTAAAAAACGTAGAGAAACACATGTTTGCCCTTTTATGTCTTTATG
ATGTCAAACAAATGAATGGGATACAGCCCAAGATCCCCTAACCTGTCATCATTATAATTTACCAGAAAACGGTCTCCCGG
TGTGGGCGGGATCATCANATTCTTCCNAAGGAATTANAAGAGGTCAAAACTTGGAAGGTTGGTGTNAN
Sequence Type genomic DNA
Unitrap ID UNI3426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116380509..116380733 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028690 (Mmachc) NP_080238 methylmalonic aciduria cblC type, with homocystinuria Gene [Source:MGI (curated);Acc:Mmachc-001]

 
Come back to gene ENSMUSG00000028690


For any suggestions or comments, please send an email to unitrap@crg.es