Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12073G8
Clone ID IST12073G8
Vector VICTR76
Project tigm

Sequence tag IST12073G8BBF1
Sequence
AATATATCAAAATGTATATGTTAACAAGCATAANACCACTCTTATATGTATCAAAAGATGGCCTAGTCGGCCATCTTTTG
ATACATATGCAGCTAGAGTCAAGAGCTCCGGGGTACTGGTTAGTTCATAATGTTGATCCACCTATAGGGTTGCAGATCCC
TTTANCTCCTTGGGTACTTTCTCTAGCTCCTCCATTGGGAGCCCTGTGATCCATCCATTANCTGACTGTGGGCATCCACT
TCTGTGTTTGCNANGCCNNNNNATANTCTCACAAGANACAGCTACATCTGGGTCCTTTCNATAAAATCTTGCTANTGTAT
GCNATGGTGTNNNCGTTNGAANGCNNATNATGGGGTANATCCCTGGATAANGCNNTCTCTACATGGNCNANCNNTTCATC
TCANCTCNAAACTTTGTCT
Sequence Type genomic DNA
Unitrap ID UNI35250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 341236..1665263 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069044 (Usp9y) NM_148943 ubiquitin specific peptidase 9, Y chromosome Gene [Source:MGI (curated);Acc:Usp9y-001]

 
Come back to gene ENSMUSG00000069044


For any suggestions or comments, please send an email to unitrap@crg.es