Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6388-NL
Clone ID PST6388-NL
Vector U3NeoSV1
Project escells

Sequence tag PST6388-NL
Sequence
AAAAACCTCTCCTCAAACTGGCAGGCAGTTAGGGAACACAATGTGCGTAGGACGCGGTGGGTACACTGTCTACTGTGTTC
AGTTACTAGTGAGTCGTAGGACAATGTTTCTTAAGGACTCTCTCCCTGTGACTGTTACAAATTTGTTTTGTGTTTATATG
TGTATGTATATATGTGTTTCTGCTGTATACATATGTATACAGGCACACGTGTAGTCATACTTGTGTGCAGGCTGAAAATC
CATGTCCATTGACTTCTTTGATTATTCTTGTTT
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23735387..23735659 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es