Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AH0106
Clone ID AH0106
Vector pGT0lxr
Project sanger

Sequence tag AH0106
Sequence
TCATCCTAGCCTTCCCGCACTTTTACTCTTTACTTGAGAGTGCGGAGCTGCAACCTGGGAGCCGGACGTGTCCGCGAAGA
TGGCGGGCCGG
Sequence Type mRNA
Unitrap ID UNI2801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103815284..103815338 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es