Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15043B5
Clone ID IST15043B5
Vector VICTR78
Project tigm

Sequence tag IST15043B5BBF1
Sequence
CCTGTATACTGTAATTAAGATAATTACAAGAGTAATCATCTTATGAGAGCGCTCATACAGCTCACTTCATACAANACTGT
GACAGAGTTANNNANTTATGTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15043B5HMR1
Sequence
ATCTCAACTGGCANCAGGCACAAAATAGGAGACAGCTGCCAAGAAGCTCTCTGCCACGCCGGAATGTATCACCGCATTTT
GTTAAATCCTTTATCTACATAGCTGCCACAGTCTGCACGTGTTAGCGTGTGAACTTTGTATTGAATCANAGCAAAGTGTC
TGAACTAGATGGATCATAAATTANCAAGTGACAAACTTCANGATCCCCCTTCTTCTTTCTCTGCTTCTTGATAANCAAAG
TGAAATAAGAGTTTGACATGCCAAAGTGCTGGAGGGTGATTTTGANNCANGCNTAATCCTGANGAAAGCAACAAGGCATT
TCTCTCTGCTTGATCNACANTN
Sequence Type genomic DNA
Unitrap ID UNI33923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8596994..8597332 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]

 
Come back to gene ENSMUSG00000052551


For any suggestions or comments, please send an email to unitrap@crg.es