Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10748C9
Clone ID IST10748C9
Vector VICTR76
Project tigm

Sequence tag IST10748C9BBF1
Sequence
TTTCTCGCTAGTATAGGGGCCGGTGCTATTGCGACGCCAGGCCACAGATGGAGGCAGGGAAGGGGCCGCACCTGTCATGA
CGAGTCGAGTCTTGGAACAGAAGGCCAGAACCTTTGAGAAAATGACAGGCAGGCTGTCTTTTGTCCTTTTTCCTCAAAGC
TGGTGTAAGTCCAGCGAAGAAAGTCCAAGTGCAGACTTATGTGAAGGGTTTTTGAGGTTCTAGAAGGGGATGCACAGCTA
GCTAGTTACATGAGCTCCTTACTTCCCTTCATTGTCAGATGTCTTTTTCTCTTTAACCTTTTTAAATATTGGGGAGGAGG
CATGTGCGTGTCATGGCGTTGGTGAGGAGGGTAGAGGACATCTGANGCTTTTGGTCCTCGCTGTTCTCTGGGTACACCAG
CCTCACAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66547693..66548103 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10748C9HMF1
Sequence
TTTCTCGCTAGTATAGGGGCCGGTGCTATTGCGACGCCAGGCCACAGATGGAGGCAGGGAAGGGGCCGCACCTGTCATGA
CGAGTCGAGTCTTGGAACAGAAGGCCAGAACCTTTGAGAAAATGACAGGCAGGCTGTCTTTTGTCCTTTTTCCTCAAAGC
TGGTGTAAGTCCAGCGAAGAAAGTCCAAGTGCAGACTTATGTGAAGGGTTTTTGAGGTTCTAGAAGGGGATGCACAGCTA
GCTAGTTAN

Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66547857..66548103 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es