Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5997-NL
Clone ID PST5997-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5997-NL
Sequence
CGATGTTGAACAGGTGTCTGTCGTCATCAATTTTGACCTCCCTGTGGACAAGGATGGGAACCCAGACAATGAGACCTACC
TGCACCGCATTGGGCGCACTGGCCGCTTTGGCAAGAGGGGTCTGGCGGTGAACATGGTGGACAGCAAGCACAGCATGAAT
ATCCTCAACAGGATCCAGGAGCATTTTAGTGAGTGCCGGGTTGGCTCTGCCTGGATCCCTTTCAGAGGGGGTGTGGGAGA
GGGCAGGTTTTCGTGGTCCCTGCATATCCGGGGCTCAGG
Sequence Type genomic DNA
Unitrap ID UNI15203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113500238..113500516 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015023 (Ddx19a) NM_007916 DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI (curated);Acc:Ddx19a-001]

 
Come back to gene ENSMUSG00000015023


For any suggestions or comments, please send an email to unitrap@crg.es