Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508C5
Clone ID IST14508C5
Vector VICTR74
Project tigm

Sequence tag IST14508C5HMF1
Sequence
TGGTACCTTTTGGGGAGGCGAGGTAGAGCCGGAGAATATTTTTTATTTTTAACNAAAATTTGGTANCNNCCTCTTTCAAA
CCGGGTTTATCTCACAGGAAACTCAGAAATGGTCAAGCCGGACCTTCCCTTGCAGTAAGTATCTCTGCACCAAGCGGTGC
CCATACTGAATTTGTN
Sequence Type genomic DNA
Unitrap ID UNI15587 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55707455..55707629 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8762022..8762196 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52080660..52080834 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19315106..19315280 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9576764..9576938 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88518093..88518267 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60341109..60341283 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40542731..40542905 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52918274..52918448 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27139347..27139521 167
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 44878576..44878750 167
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es