Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5568-NL
Clone ID PST5568-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5568-NL
Sequence
CATGCAGTAAGTATTCTGCTTGACAAGAAATAGTAACTTAAGTATTTATTGAATGGAGTGTTATACCAGATGTCTCAT
Sequence Type genomic DNA
Unitrap ID UNI10936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95658909..95658986 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015748 (Prpf3) NM_027541 PRP3 pre-mRNA processing factor 3 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918017]

 
Come back to gene ENSMUSG00000015748


For any suggestions or comments, please send an email to unitrap@crg.es