Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10320D11
Clone ID IST10320D11
Vector VICTR76
Project tigm

Sequence tag IST10320D11BBF1
Sequence
CTGGACATAATGATGCCTTAGGAACATAGTAAGGGCTCCAACCCTGCTCTGGGGCTTATAGAAGGTCTCCTACAAGTGTC
ACTAAGCTAAGACCCAAAGGAAGACTGTATATGAACCAAGGAAAGAAAAAAATAATGTTCGAGGCCAANAACCCTCAGTA
GGAAGGTCCAGACAGTGTTTGGGAACACAGCAGCTGAACATGCCTGGTGGAGGACACCAGTGGAAATCATAGTCTTGTCT
TGTCTTGTCTTTTCTTGTCTTTTCTTTTCTTTTCTTTTCTTTTTCTTTATTTTTTANACNGTGTGTAGTTGGAGTTTTCT
ACTTTGTGGGTTCTTCTTTTCCTTATTGCCACCCTCCACCCCTGGCTCCNTTCCCCCTACACCCCAGTTTTATCCCCTAA
CACTAGATAGGAGAGAAAAAAGAATAGAGGGGAGAAAGANATAGAGATCCCTAAATTTATTTAACTTTTTCTTTCTTCTT
GTTNNTTCTTTGCTTGTAGCTGGTTTTTTGCTACCTTATGGTTTTCTTCCTCACACACCCCNCC
Sequence Type genomic DNA
Unitrap ID UNI30789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88361026..88361563 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es