Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12312E4
Clone ID IST12312E4
Vector VICTR76
Project tigm

Sequence tag IST12312E4HMF2
Sequence
TTGGGATTAAAGGCGTAAACCATGCTTTTAGGGCTGGAGAAATGGCTCAGCAGTTAAGAGCACTGTTATTCTTGCAGAGG
ACCTGGGTTCAGTTCCCAGCACCCATATAGTGCCCCACAGCCCTTCTCAACCCCAGCCCCAGGGGGTCTGGCAACTTCTG
ATGTTCATGGTTATCAGGCACACACATGCTACCCATATAAACACGCTAGCAACACACTCACACAAATCTTTTGTAAAAGG
TAAAAAGATGTTCTAAAGATGAGGCAGGAGGATTGCCATGAGTTCTATAATGGCAGACAGCCTCTTGGCTCATGAGAGGG
AGAGGTTTCTTAGCCTAGGGAGGACAGTGATGGGACGGGGTTGCTCTTCACCTGAGCCAGGCTGGAACAAGATGTTTTCT
CCTGAACAGACAGTGATCATTGGCTCCTACTTGATCGCGCACGGCTTCTTCAGCGTCTATGGCATGTGCGTGGACACGCT
GTTCCTCTGTTTCTGTGAGTGGCCCCTTTATCTCANCCCACCNNGNACCCN
Sequence Type genomic DNA
Unitrap ID UNI22962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21156502..21157031 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]


Sequence tag IST12312E4BBF1
Sequence
ATAGAAGAACGCGCAGGGACTATTTCTCTCCACCCTTACAGCGCCCCAGGGATCAAATTCGGGTCATTAGGATTTGTGGC
AAGAGCCTTTATCTCCTGAGCCACCTTGTCAGCCCTATATGACTTTCTTAAATCAAAATGAAGGGCTAGATCGATGGCTC
AGCAGTTAAGAACTCCGGCTGTTCTTCCAGAGAACCTGGGTTTCAATTCCCAGCACCCACACAGCAGCTCCTAACTGTCT
GTAATTCCATGTCCAGGGGATCGGACACCCTCACACAAACATACATGCAGGCAGAATGTACACAAAATAGAAATAAATTA
TTGGGAAAAAACCTCATCCTCACACCTTCAATCCCAGCACGTGGGAGGCAGANGCAGGCGGATTTCTGAGTTTGAGGCCA
GCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGANAAACCCTGTCTTGAAAAACAAGACAAAAAAAGAA
NGAAAATAAATAAACCAAAACGCTNCCAATTAAAAAGCATTTCACTCTGGGGCCATTTCACTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60775814..60776357 536
NO GENE  

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es