Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568F9
Clone ID IST14568F9
Vector VICTR74
Project tigm

Sequence tag IST14568F9HMR1
Sequence
NGNNNAAAGGTGATTCTGGGTGACCCTGCANANTANCGCTCGGTCANAAAGTACCACTTCCATGTTTGAAGGTGGCTTTT
CTATACACTTCAGCTGGAATATCAAACTGTGACAGATTGAGACATGTTCAATACAGATGCCTAGGCAGAATCCGATGATG
CCTGTCAAGCCANATAGTGAANAGATTTGCANAAAAGGAGAAACATCCNTTCTTATCACAAAAGAAGTTTTTATTTGGCA
AGATANANATTTTTGAAAAAATATGTCATTTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119494267..119494537 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]


Sequence tag IST14568F9BBF2
Sequence
CTAAACTTCTCAGCCATCTCTCCAGTCCCTGATCTACTTTCAGTATAATTTCATTCAGAATAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 134917514..134917587 74
NO GENE  

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es