Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11533E8
Clone ID IST11533E8
Vector VICTR76
Project tigm

Sequence tag IST11533E8HMR1
Sequence
TCANCATGGCCTACAGATCCNGTTCCAGGACTACACAAAGAAAACCTTTGGAGTGGGGGATGGGGCAAGGAGAACAAAGT
AAAAT
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84845539..84845623 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST11533E8HMF1
Sequence
CCAACAGTTCCAGGTTCAGTGAGAGGCCCTGTCTCAAAAACTAAGATGAAAAAAAAATAATTGAGGAANACACACAATAT
TAACCTCTAGTCTCCATGTATACACACACATGCACACACTGGANATAAACTTTGCAGGAATGCAGTTGCCACAACAAACT
TTGAGGGTTTTGTTTTTGTTTTGTTTTGTTTTTTTCTTGTCAATTTTGTGTTCTCCAGTCTCTTCTGCCTTTCTTTGCAT
GGTTGTCNGNNCTTCNGNNNGNGGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI29720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 110432648..110432916 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021699 (Pde4d) NP_035186 phosphodiesterase 4D, cAMP specific Gene [Source:MGI (curated);Acc:Pde4d-001]

 
Come back to gene ENSMUSG00000021699


For any suggestions or comments, please send an email to unitrap@crg.es