Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13286B3
Clone ID IST13286B3
Vector VICTR74
Project tigm

Sequence tag IST13286B3HMF1
Sequence
CTGTTCCCTTGGACCTACAGTTTGTGGAACCCTGCCGCTCTGACCNCTGGT
Sequence Type genomic DNA
Unitrap ID UNI35264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5464314..5464363 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024911 (Fibp) NP_067413 fibroblast growth factor (acidic) intracellular binding protein Gene [Source:MGI Symbol;Acc:MGI:1926233]


Sequence tag IST13286B3BBF1
Sequence
CTGTTCCCTTGGACCTACAGTTTGNGNAACCCTGCCGCTCTGACCACTGGCCACTGAGTGATGTGCGGCTCTTCCTCAGC
CAGTATTCANCGTCAGTCCACTCCCTGGATGGCTTCCGGTGAGAGGTGCCNGGCCTGCTGGCTAACTTCCTTGCCCTCCA
NGNNNNTCANGCTTCTCTGTTGAACTGCCCTGTGGGTGGAAGCTCCNCCTCTNNNTGTTGTGACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024911


For any suggestions or comments, please send an email to unitrap@crg.es