Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10126D4
Clone ID IST10126D4
Vector VICTR76
Project tigm

Sequence tag IST10126D4BBR1
Sequence
TGTCACGGAATAATGCTTTCCTCCACATTTGCTTCTTGGGATGATGTTTGTGCAGGAATAA
Sequence Type genomic DNA
Unitrap ID UNI35265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13553255..14128716 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]


Sequence tag IST10126D4BBF2
Sequence
ACATTTCCATACTGCTGTTTATCACCAAAGGAAGTCAAGACTGGAACTCAAGCAGGTCAGGAAGCAGGAGCTGATGCAGA
GGCCATGGAGGGATGTTACTTACTGGCTTGCTCAACCTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 73182345..73182464 116
NO GENE  

 
Come back to gene ENSMUSG00000060657


For any suggestions or comments, please send an email to unitrap@crg.es