Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14587F2
Clone ID IST14587F2
Vector VICTR74
Project tigm

Sequence tag IST14587F2HMF3
Sequence
AGACTTGCCACTTTCCATCCCCAGCTTTCTTGCTTAGAAAAAAATGACAAAGGCAAAGTGGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29326792..29326857 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]


Sequence tag IST14587F2HMR1
Sequence
GTCTAAGATGGCATAAGATGGTATAAGCTGGCAGCTAGAGATGAGGGAAACAGATATCCAAACACCCCAGAATCTAGCCT
CACCTGTACCCTGGTTGCCTGCTGACCAACAGCAAACTGCCTCTCACCAGACTCACTTCCCTGCTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29326854..29327008 155
NO GENE  


Sequence tag IST14587F2BBF2
Sequence
ATCTCACTCTAACTTTGGCTGACCTGAAACTCATTATTGTAGACNAGGCTGGCCTCAAACTCANANATCCAGCCACCTCT
GCTTCCTGAGTGCTGGGACTAAAAGTCTGTGCTACCATGTCCACAGCCTGCTTCTCAGCCTGACATGCATGGTTGCTCTT
GTCACAGACTAAAGGGATCATGTATTCACTTGTCTTGGACCAAAACATTTTCTTGCCTTCTTATCCAGGGGGCTATTTAG
AAACTGTACATCTGAGGATCTCAGCCCACGAAGCTTTAAGAAAGTGAATTTGAGCTGGAGAGATGGTTTCACTTGCTGCT
CTTCCTGATGACCCAGGTTCAATCCCNAAGCTCACAACTGTCTGTAACACCCTGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6078434..6078815 374
 
EST/CDNA Est Name
  BY062368.1 - CN841734.1

 
Come back to gene BY062368.1 - CN841734.1


For any suggestions or comments, please send an email to unitrap@crg.es