Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981D12
Clone ID IST14981D12
Vector VICTR76
Project tigm

Sequence tag IST14981D12HMR1
Sequence
GGGCNACACAAAGAAAACTCACAACTCTCCATAATTCTAGCCCCAGGGGATCTGATACCTGCTCCTGGCCTCCACTAGGC
ACACATGTAGTTACACATGTAGGCATACCTGTAGGTAAAATACTTANACACATAAAAAATGTTTTTAAAAAAATGAAGAG
GAAATGCAGGGTGGGAAGAAGGGTATGGCACAAGCATAAAGACCTGAGGTCAGATCCGCAGTTCTCATGCAAAAGCCAGG
TGCAGTGTATCCTCTGTAACCCCAAAACTCATCAGGCTGAGATGGGCANATCCTTNNAGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591912..45592212 291
NO GENE  


Sequence tag IST14981D12BBF1
Sequence
GCCCTGACTGCCCTGGAACTCAACTCTGTAGGCCAGGCTGGCCTTGAACAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591858..45591915 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es