Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0520
Clone ID AG0520
Vector pGT0lxr
Project sanger

Sequence tag AG0520
Sequence
GCATTTTGGAAGCTCTAGAACAGTTCTGCTCTCATGGCTGCACCCTCTCCCTCCAGCTCTAGCCTCTGTGAACGGCTTCA
CCAGGACATGATCCTCGAGGAAGAACAAGCCAGTTCTTGCGATTCTGGAATCATGGCTCAT
Sequence Type mRNA
Unitrap ID UNI2806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30571183..30571322 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047473 (Zfp30) NM_013705 zinc finger protein 30 Gene [Source:MGI (curated);Acc:Zfp30-002]

 
Come back to gene ENSMUSG00000047473


For any suggestions or comments, please send an email to unitrap@crg.es