Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11689D1
Clone ID IST11689D1
Vector VICTR76
Project tigm

Sequence tag IST11689D1HMF1
Sequence
GGACCTTCCGCAAGTTTAGACAATGCATATCTTTGAAATGTAGTTATATTCTAGCGAACTTAGTGACCCCAGGAGTGATG
GTAACTTTTGTTATCCTTTTGAAGGCTCAGGCACCACAGTAGGCATCACATGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222834..55222970 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022179 (4931414P19Rik) NM_028890 RIKEN cDNA 4931414P19 gene Gene [Source:MGI Symbol;Acc:MGI:1921609]

 
Come back to gene ENSMUSG00000022179


For any suggestions or comments, please send an email to unitrap@crg.es