Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14252H4
Clone ID IST14252H4
Vector VICTR74
Project tigm

Sequence tag IST14252H4HMR1
Sequence
TGGGACATTGTTTTTTAATCTTAAAATTAAAATGAACTTTTATCTGGTTGTTATTGTAGCATTTGGAAATTGTANTTTAG
TTGGTCTCATTCATTTTTGGTTCAGCCATATGTGGAGTGTTCCTTGTCTTGTTTTTTCTTTTTCTTTTTTCTATTACTGT
TTTAGAGTATGTANTTTAGACTGTACTGAACTTACTGTGTAACCAAGGTCTGANCTTGCTATGCANCTGAANATGACCTG
AAATTCCTAACCCTTCTGTCTCTACNTTCCAACTNNNATTACAGGCN
Sequence Type genomic DNA
Unitrap ID UNI20037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39020124..39020409 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035236 (A930041I02Rik) NM_178778 RIKEN cDNA A930041I02 gene Gene [Source:MGI Symbol;Acc:MGI:2443716]


Sequence tag IST14252H4BBF1
Sequence
CCAGTTCACTGTTCTGCCAACACATCCAGGGCTGGCATAGGAAATAACTCCAGATAAAGCCCTAAGATATCCTGGGTTAA
AAACCTGAGTGTGAGGGAGCCTTTCTCTCACAAAGGATAAACAGGCTGAGAAAGAAATGAGGGAATATTCTTCAAAATAG
TCATAAATAAAATAAAATAAAATACCTTGGTGTGACTCTAACTAAGGAAGTGAAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39020407..39020628 222
 
EST/CDNA Est Name
  BY783760.1 - BY788366.1

 
Come back to gene BY783760.1 - BY788366.1


For any suggestions or comments, please send an email to unitrap@crg.es