Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14319A9
Clone ID IST14319A9
Vector VICTR74
Project tigm

Sequence tag IST14319A9BBF1
Sequence
ATCTGCTAAGCATCCATGAAGAGAGGCACAGATGTCAGGCAAATTGTTCCTGAAATTAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 64384140..64384204 65
NO GENE  


Sequence tag IST14319A9HMR1
Sequence
TGAGGGAGCGGCGGGTGGCACCCTCTTCCCTTCACAAGATGGCGCCGTGGGAAGAGCCTGGGGCCCTGGCGGTCTCCAGC
CCGGTCTTTGGGGCTCTGTCCCGGCTACTGAGCCGGATCGCATCCGGGGTGACGGGGGTGGCTCN
Sequence Type genomic DNA
Unitrap ID UNI19128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53619063..53619206 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017831 (Rab5a) NM_025887 RAB5A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105926]

 
Come back to gene ENSMUSG00000017831


For any suggestions or comments, please send an email to unitrap@crg.es