Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14354E12
Clone ID IST14354E12
Vector VICTR74
Project tigm

Sequence tag IST14354E12HMF2
Sequence
GTTTGACGGTTGCTATGGATAATTCTTGATGACACATGGAGTGGTTAGTGTTTTGCTGGCCCCCTTAAGAACAAGTGATA
ATAAGCAGCAAGGACCTCTAGAATGCTCCTTTACTCTTGGTTTTTTGAGACAGGGTTTCTGTCAGTCACTGCCTGGCTCC
TTTATTCTTGCTGGGCATCTAATATCACTTTTCTTTCCCCATACCATTGCTAGCCCCAGTGTTCACATAATCTGTAACTC
CCGACTAGGTGGAGAAATGGAACCGACGTGATCAGAAGCTGCTGGANGCGGTGCANCGGGGGGACGTGGGACNCGTGGCT
GCCTTGGCCTCTN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96481808..96482139 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]


Sequence tag IST14354E12BBF1
Sequence
CCTCAAACCAGGCTGGGTCATGGTGGTGGCAAAAAACTGCAAGGAATGGATGCCTGGCGACGGAAGACACAAATCCTTTT
TTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37126097..37126193 97

 
Come back to gene Mm.246609


For any suggestions or comments, please send an email to unitrap@crg.es