Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0505
Clone ID AG0505
Vector pGT0lxr
Project sanger

Sequence tag AG0505
Sequence
CACGCTCCTCTTGCAGANTCGATCCCCTTTATTATCCTTCCCTCGCCTTCTCTCTTTCCCCCACTCGTATCCTTCTCTGA
TCCCTTCCCCTGCAGACCCGGAAGTGCAATCGAACTTGGTCGGGGCGCGGATCTTGAGAGAGAAAGTCCGAGCCAGGGCG
CAAGGGAGTTCGCCCAGAGATCTGGAAGGCCACGCCTCCTCGCACCTACCCTCTCAGCATTGCAGCTGGGGACAGAGCTC
AGATTTGCTGTCTAGGATCGATTTGGATGAACTCATGAAAAAGGACGAACCACCTTTTGATTTTCCAGATACACTGGAAG
GCTTTGAATATGCTTTTAATGAAAAGGGGCAGTTAAGACACATAAAAACTGGGGAACCATTTGTTTTTAACTACCGAGAA
GACTTACACAGGTGGAACCAGAAAAGATATGAAGCTCTGGGCGAG
Sequence Type mRNA
Unitrap ID UNI2808

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 77847960..77901199 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064138 (1110033M05Rik) RIKEN cDNA 1110033M05 gene Gene [Source:MGI Symbol;Acc:MGI:1915925]

 
Come back to gene ENSMUSG00000064138


For any suggestions or comments, please send an email to unitrap@crg.es