Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990F3
Clone ID IST14990F3
Vector VICTR78
Project tigm

Sequence tag IST14990F3HMR1
Sequence
GTCTACAGAGTGAGTTCCGGGACAGCCNGGGCTACACAGAGAAACCCTGTCTCGAAAGACCAAAAAACAAAAAAGCTAGA
GCTGAACTTCTTAGATTCCATTCTCAGCTGCTTAGCTGCTTGACTCTGGGTCTCCTTCAGGCTCCCTGCCTCAGTTTCTC
TACAAAAATAGTAGTTTTTTCCCCCCTCTGCTCACTTCATAATACTGCTGTGAATTCAGAGCAAAGCANTATATGAACCA
AAGAATCTTGTTACTGANACTGGGACATAGGGACAGATGCTCACCACTTCTTCGAGGCCGGACTANTTGTTCCAAGAAAG
GTACCACATCCTGGCTTTCCTCTGTCNGGGGATTCNNTTCCTANAGGAATTAAGGGCNNGGTTCAAACANGACCTCCCAN
ANACAAACNNNCAAAGAGCCTGTCANAANAACCNTCNNCCAGTNNCANACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14990F3BBF1
Sequence
ANACCAGGCTGGCCTTAAACCCAGAAATCCGTCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACCG
CCCAGCTTCAGCTCTACCTTCTAAAGCTCATTTGCCACATGGAGCTGCTAGCTGTGGACCCTACCACAAATGACCAGGCG
TTAAACANACTCCAGGAGTTCTCCTAAANAGGCCCANGCTTCCNNAAATAAAGGCTCCCNNGAATCANTGGTTCATTACT
ANATATATTACTGGTTTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI8554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69507711..69507969 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es